Skip to Main content Skip to Navigation
Journal articles

Conformational Studies by 1H NMR of the HIV Enhancer: the Transcription Factors NF‐κB and Sp1 Binding Domains

Abstract : The solution structures of two DNA non-palindromic duplexes of 24 base pairs and corresponding to the 3 NF-B-binding site and the adjacent 5 Sp1-binding site of the HIV-1 long terminal repeat (5LTR) were analyzed by proton two-dimensional nuclear magnetic resonance spectroscopy. The first sequence d(GGGGACTTTCCAGGGAGGCGTGGC):d(GCCACGCCTCCCTGGAAAGTCCCC) corresponds to the wild-type LTR duplex (24mer-N), and the second sequence d(GCTCACTTTCCAGGGAGGCGTGGC): d(GCCACGCCTCCCTGGAAAGTGAGC) (24mer-M) contains a specific mutation (lightface letters) abolishing NF-B binding. Assignment of protons essential for structure determination were obtained and structural features of both duplexes were analyzed. The overall structure of the duplex is of the B form but several significant local structural deviations were found. First, from analysis of NOE cross-peak intensities between adenine H2 base protons and sugar H1 protons, it was found that the CTC mutation results in widening of the minor groove with presumably narrowing of the major groove, thus impairing the binding of NF-B to its responsive element in the HIV LTR. Second from chemical shift analysis of H1 sugar protons, some unusual structural features were found at the junction between the homopurine:homopyrimidine stretches, that is, at the junction of the NF-B and Sp1 sites, consistent with the known synergism between NF-B and Sp1 functions in the HIV LTR. The scopes and limitations of DNA fragment studies of such a size are discussed.
Complete list of metadata
Contributor : Cécile Roux Connect in order to contact the contributor
Submitted on : Friday, April 17, 2009 - 2:54:48 PM
Last modification on : Thursday, April 7, 2022 - 10:10:20 AM

Links full text




Muriel Delepierre, Patrick Sodano, Catherine Gouyette, Abdelkader Namane, Jean Igolen, et al.. Conformational Studies by 1H NMR of the HIV Enhancer: the Transcription Factors NF‐κB and Sp1 Binding Domains. Magnetic Resonance in Chemistry, Wiley, 1996, 34 (13), pp.S67-S80. ⟨10.1002/(SICI)1097-458X(199612)34:133.0.CO;2-F⟩. ⟨pasteur-00376433⟩



Record views