Senegalese patients and samples have been described in Robert et al21. Briefly, two groups of patients were recruited at the Hôpital Principal de Dakar. The first group corresponded to SM patients (aged <1 to 63 years) admitted to the Intensive Care Unit (27 children and 29 adults). All presented at least one of the symptoms defined by the World Health Organization 22 as criteria for severe malaria (severe anaemia, altered conciousness (Glascow Coma Scale score of ≤ 9), convulsions, hypoglycaemia, acidosis, respiratory distress and impaired visceral functions). The second group consisted of 30 outpatients with an uncomplicated malaria attack (UM) (see Additional file 1 and Additional file 2). From April to August 2009, 101 children with symptomatic P. falciparum malaria were recruited in the CNHU of Cotonou, Benin. These children lived in the urban area of Cotonou where malaria transmission is perennial, with two seasonal peaks corresponding to rainy seasons, from April to July and September to November. A survey conducted in 2000 showed heterogeneous malaria transmission in the city of Cotonou, with transmission varying from five, 29 and 47 infective bites per person per year near the beach, in the centre of the city and in the outer-urban lagoon areas, respectively 23.

The inoculation rates were undoubtedly lower during the study period, due to the introduction of effective prevention and therapy. At admission, children were assigned to the SM or the UM group as described elsewhere 24. Children age, gender, place of residence, anti-malarial drug intake by the patient, and duration of symptoms prior to enrolment were documented by questionnaire. For each individual a 5 mL venous blood was collected in EDTA Vacutainer® tubes before drug treatment administration. Peripheral parasitaemia at admission was assessed by microscopy on Giemsa-stained blood films and blood smears. In addition, for each individual, two drops of fresh blood were collected onto filter paper for molecular study.

Characteristics of the recruited Beninese subjects are presented in Additional file 3 and Additional file 4. Forty-seven subjects and 54 subjects were included in the UM group and in the SM group, respectively. The sex ratio (M/F) of the SM group [1.7 (34/20)] did not differ significantly from that of the UM group [1.35 (27/20)]. Subjects with UM were older than children with SM (mean; SD 107.2 months; 156.6 vs 34.8 months; 21) (Mann Withney test, p < 0.001, for comparison between the groups). Patients of the SM group had higher parasite density than patient of the UM group (mean density 10.53% vs 3.57%). Forty-seven children had severe malarial anaemia only, one child had cerebral malaria only, and six children had both severe anaemia and cerebral malaria.

This Beninese study was approved by the ethics committee of the “Faculté des Sciences de la Santé” of the University of Abomey-Calavi in Benin. For each child, a written informed consent from parents or legal guardians was obtained. The study was conducted in accordance with the Declaration of Helsinki.

Leukocytes were removed from infected blood following dilution with equal volume of phosphate-buffered saline (PBS) and separation on Ficoll-Paque density gradient. Depleted blood was washed three times in PBS. Infected erythrocytes were suspended in complete RPMI culture media supplemented with 10% human AB-positive serum at a haematocrit of 5%. For isolates with parasitemia >5%, dilution with washed non-infected 0+ RBC obtained from a unique non-P. falciparum infected donor was performed. Parasites were cultured for 72 hours at 37°C using the candle jar method 25 and culture medium was changed daily.

Saponin-treated, ring-stage parasites were harvested by centrifugation, and lysed in 10 pellet volumes of Trizol (Gibco) before freezing at −80°C. Total RNA was prepared from thawed samples following the manufacturer’s instructions. RNA was treated with DNAse I (Invitrogen) for 15 min at 37°C in presence of RNAseOUT™ inhibitor (Invitrogen). PF11_0512 mRNA was transcribed from 1 μg RNA into cDNA using Titan One tube RT-PCR kit (Roche) in a final volume of 50 μl of reaction buffer containing 0.2 mM dNTP each, 5 mM dithiothreitol, 5 unit RNAse inhibitor, 0,4 μM primer 5′ CGCTCGAGATGAAACAACATAGTTC and primer 3′ GGCAGATCTTTTTAATAGTTCATTTATTGTG, and 1 μl of enzyme mix (AMV reverse transcriptase, Taq DNA polymerase and Tgo DNA polymerase). After 30 min incubation at 48°C, the reaction was terminated at 94°C for 2 min and immediately processed for PCR amplification. Thirty-five temperature cycles were conducted as follows: denaturation at 94°C for 30 sec, annealing at 52°C for 30 sec, and extension at 68°C for 2 min 50 sec with a 3-min final time increment.

Data from the two patients groups of Benin and Senegal were combined to assess the association between mutant allele and severity of malaria. As some isolates harboured both wild and mutated parasites and because the proportion of each genotype was unknown, two different analyses were performed: in the first one, mixed isolates were merged with mutant isolates and compared with wild isolates; in the second analysis, mixed isolates were excluded from the analysis and mutant isolates were compared with wild isolates. Because the two groups differed in terms of seasonality of malaria transmission and in terms of age, the odds ratio of mutant allele were adjusted for age and country. Groups were compared using the Wilcoxon ranksum test for continuous variables and the Fisher’s exact test for categorical variables. Then a logistic regression was conducted to identify factors associated with mutant alleles, and to estimate odds ratios and 95% confidence intervals (CI) for the association between exposure variables and mutant alleles. Statistical analysis was performed using Stata 10 (Stata Corporation, College Station, TX, USA).

Previous predictions based on alignment with resa1 gene generated a gene model with a single intron and an internal TAA stop codon in resa2 exon 2 16. Partial sequencing of the resa2 mRNA expressed in vivo by parasites collected from an infected Saimiri monkey was consistent with this model 19. However, the actual bio-informatic prediction in PlasmodB (PlasmodB 8.1) indicates the presence of two additional introns, which once spliced out, remove the stop codon in the resa2 mRNA.

To clarify the gene structure, amplification of resa2 cDNA by RT-PCR was performed using P. falciparum RNA purified from a patient isolate and the K1 culture adapted strain. Sequencing analysis of cloned RT-PCR fragment product showed that a single intervening sequence is spliced out in the final mRNA. A very minor band, about 100 bp smaller, was also visible following RT-PCR, and may correspond to the PlasmodB predicted cDNA. However cloning failure of this minor product excluded assessment of this prediction. A unique ORF with the described premature translation stop was found in the patient isolate [Genbank access number: JN183870], while the K1 strain harboured the T1526C mutation [Genbank access number: JN183869]. Thus, resa2 behaved as a transcribed pseudogene in some strains harbouring the T1526 allele, and as a normal gene in those possessing a 1526C allele, which codes for a full length coding sequence.

PF11_0512 sequence available in both PlasmodB and GenedB database also differs from the original sequence by a frameshift in the coding sequence, an event not detected in both K1 and SAMA cloned cDNA sequence reported here. This frameshift results from different A residues in a polyA stretch, which was found to be associated to frequent polymerase slippage as evidenced by sequencing of many uncloned or cloned PCR products encompassing this region. Interestingly, Blast analysis against P. falciparum sequences available at Broad Institute or Sanger Institute indicated that number of A residues in this genomic region may differ; some strains, such as Santa Lucia strain or Ghanaian isolate shared a similar number of A with SAMA and K1 parasites.

The proportion of isolates harbouring wild, mutant and mixed alleles did not significantly differ between groups from Senegal and Benin (p = 0.4). The proportion of SM and UM cases did not differ either in these groups (p = 0.2). However age ranges were significantly different between the groups (p < 0.0001) as more adults were included in Senegal.

The amplification of the resa2 region encompassing the T1526C mutation was obtained in 39 SM isolates and 21 UM isolates from Senegal ( Additional file 1 and Additional file 2). RFLP analysis using MseI enzyme was performed as the restriction site is affected by the T1526C mutation. The T1526C mutation was found in six of the SM isolates (15.4%). In UM isolates, only one sample harboured the mutant allele (4.8%) in association with the wild allele. The mutant allele was not found more frequently in SM cases than in UM cases (p = 0.2). The presence of the mutant allele was not associated either with parasitaemia (p = 0.3).

In the group of Beninese children, resa2 PCR amplification was successful for all isolates. Sixteen isolates (15.8%) harboured the T1526C allele, 11 among the severe cases and five among the UM cases. Six isolates (three corresponding to SM and three to UM) harboured both wild and mutant alleles. The mutant allele was not found more frequently in SM cases than in UM cases (p = 0.2) (Table 1). There was a trend towards the association of the presence of the mutant allele and parasitaemia > 4% (p = 0.06).

When data from Senegal and Benin were pooled, severity of cases was not significantly associated but showed a trend towards association with the resa2 T1526C mutation (p = 0.09).

In the group of Senegalese patients, there was a trend towards the association of the presence of the mutant allele and severity of malaria (p = 0.06). The presence of the mutant allele was not associated with parasitaemia (p = 0.3).

In the group of Beninese children, there was a trend towards the association of the presence of the mutant allele and severity of malaria (p = 0.08) (Table 2). There was a trend towards the association of the presence of the mutant allele and parasitaemia > 4% (p = 0.05). In multivariate analysis, this association became statistically significant (p = 0.03) (Table 3).

When data from Senegal and Benin were pooled, severity of cases was significantly associated with the resa2 T1526C mutation, Odds Ratio = 5.7; Confidence Interval 95% : [1.26-26.1](p = 0.008). The association between the presence of mutant allele and severity of malaria remained significant when age and origin of isolates (Benin or Senegal) were controlled for in a bivariate analysis.

Multiplication rates of P. falciparum parasites isolated from SM or UM patients in Benin patients were compared in a short-term, 72-hour in vitro culture growth assay (Table 4). After 72 hours in vitro culture, parasite multiplication rate over 1.5 was obtained for 19 SM isolates (37%) and 7 UM isolates (16%). Isolates showing higher multiplication rates were more frequently associated with SM (odds ratio 5.9, IC95% 1.6-21.6) (Table 4). Five out of the eight SM isolates (62.5%) carrying the resa2 T1526C allele have multiplication rates ranging from 1.5 to 4.3. Two out of three SM parasites with the T1526 mutation that failed to grow were collected from patients who had taken anti-malarial prophylaxis. Growth culture failed for all mixed isolates. All UM parasites with parasite multiplication rate over 1.5 have the wild resa2 allele.