B. Victoria and C. ). , Ab to Hsp70 (SPA-810, 1/200) was from Stressgen Bioreagents Ab directed against calnexin (clone 37, 1/500) and EEA1 (1/500) were purchased at BD Transduction Laboratories. Fc Block TM and CellFIX TM were from BD Pharmingen (BD KaryoMAXH ColcemidH Solution in PBS, Alexa FluorH 488-conjugated anti- IgG rabbit and Alexa FluorH 594-conjugated anti-IgG mouse were from Invitrogen (Cergy-Pontoise, France); ProLongH Gold Antifade reagent with or without DAPI and Alexa FluorH 594- conjugated anti-IgG goat were purchased at Molecular Probes, Ab against CD63 is a kind gift from Eric Rubinstein (Inserm 602

R. Pcr, RNA was isolated from cells using an RNeasy kit (Qiagen, Germany) cDNA synthesis was performed with 2 mg RNA using oligo(dT) primers (100 ng) Superscript II reverse transcriptase (RT) and Taq DNA polymerase (QBiogene) were used for RT- PCR in a Px2 thermal cycler (Hybaid Corp, USA). 35 cycles of amplification were performed as follows: 4 min at 94uC, 1 min at 55uC, 1 min at 72uC, 10 min at 72uC, and final cooling

1. Ribosomal, forward-18S: CTTAGAGGGACAAGTGGCG; reverse- 18S: ACGCTGAGCCAGTCAGTGTA; forward-TLR3: GAG- GCGGGTGTTTTTGAACTAGAA; reverse-TLR3: AAGTCA- ATTGTCAAAAATAGGCCT. The primer pair used for TLR3 exon IV deletion is (59R39): Forward-exon4-TLR3: CTCCA- GGGTGTTTTCACGCAATTGG; Reverse-exon4-TLR3: TTC- AGGTACCTCACATTGAAAAGCC. For quantitative PCR, specific primers for TLR3 were from QIAGEN (QuantiTect Primer #QT00007714) For amplification of RABV genome the following primers were used (59R39): Real-time RT-PCR analysis was performed with an ABI Prism 77700 sequence detection system. Methods and relative quantification of gene expressions were carried out using the comparative method according to the manufacturer's instructions. Sequence of neuronal TLR3 was determined and assigned the GenBank accession number DQ445682. Flow cytometry RABV-infected and mock-infected NTera2clD/1 cells were washed once with phosphate-buffered saline Cells were fixed in 4% paraformaldehyde (PFA)/PBS for 30 min at 4uC, and resuspended in permeabilisation buffer (PB) (PBS, 1% FCS, 0.1% sodium azide, 0.1% saponin) Cells were then incubated with FITC-conjugated anti RABV NC Ab for detection of viral proteins and/or successively incubated with goat anti-TLR3 Ab (sc-Q18) followed by biotinylated anti-goat IgG Ab and finally with R-phycoerythrin-conjugated streptavidin, Primers used for amplification of the TLR3 and 18S genes were synthesised by Eurogentec (Belgium), with the following sequences (59R39)PBS) containing Ca 2+ Mg 2+ (PBS Ca 2+ Mg 2+ ), scraped (Cell Scraper, Corning) and pelleted in staining buffer (SB) (PBS, 1% inactivated FCS, 0.1% sodium azide Cells were then washed with PB. For staining of non-fixed cells, cells were washed with SB instead of PB and fixed in CellFIX TM (BD Biosciences, USA). Cytofluorimetry was performed with a FACS- Calibur TM (BD Biosciences). Results were analysed using the CellQuest TM Pro (BD Biosciences) software

R. 1. Rock, F. Hardiman, G. Timans, J. Kastelein, R. Bazan et al., A family of human receptors structurally related to Drosophila Toll, Proceedings of the National Academy of Sciences, vol.95, issue.2, pp.588-593, 1998.
DOI : 10.1073/pnas.95.2.588

L. Alexopoulou, A. Holt, R. Medzhitov, and R. Flavell, Recognition of double-stranded RNA and activation of NF-kappaB by Toll-like receptor 3, Nature, vol.413, issue.6857, pp.732-738, 2001.
DOI : 10.1038/35099560

K. Kariko, H. Ni, J. Capodici, M. Lamphier, and D. Weissman, mRNA Is an Endogenous Ligand for Toll-like Receptor 3, Journal of Biological Chemistry, vol.279, issue.13, pp.12542-12550, 2004.
DOI : 10.1074/jbc.M310175200

S. Marshall-clarke, J. Downes, I. Haga, A. Bowie, and P. Borrow, Polyinosinic Acid Is a Ligand for Toll-like Receptor 3, Journal of Biological Chemistry, vol.282, issue.34, pp.24759-24766, 2007.
DOI : 10.1074/jbc.M700188200

M. Yamamoto, S. Sato, H. Hemmi, K. Hoshino, and T. Kaisho, Role of Adaptor TRIF in the MyD88-Independent Toll-Like Receptor Signaling Pathway, Science, vol.301, issue.5633, pp.640-643, 2003.
DOI : 10.1126/science.1087262

E. Vercammen, J. Staal, and R. Beyaert, Sensing of Viral Infection and Activation of Innate Immunity by Toll-Like Receptor 3, Clinical Microbiology Reviews, vol.21, issue.1, pp.13-25, 2008.
DOI : 10.1128/CMR.00022-07

K. Fitzgerald, D. Rowe, B. Barnes, D. Caffrey, and A. Visintin, LPS-TLR4 Signaling to IRF-3/7 and NF-??B Involves the Toll Adapters TRAM and TRIF, The Journal of Experimental Medicine, vol.18, issue.7, pp.1043-1055, 2003.
DOI : 10.1038/nature01889

S. Sato, M. Sugiyama, M. Yamamoto, Y. Watanabe, and T. Kawai, Toll/IL-1 Receptor Domain-Containing Adaptor Inducing IFN-?? (TRIF) Associates with TNF Receptor-Associated Factor 6 and TANK-Binding Kinase 1, and Activates Two Distinct Transcription Factors, NF-??B and IFN-Regulatory Factor-3, in the Toll-Like Receptor Signaling, The Journal of Immunology, vol.171, issue.8, pp.4304-4310, 2003.
DOI : 10.4049/jimmunol.171.8.4304

E. Meylan, K. Burns, K. Hofmann, V. Blancheteau, and F. Martinon, RIP1 is an essential mediator of Toll-like receptor 3???induced NF-??B activation, Nature Immunology, vol.8, issue.5, pp.503-507, 2004.
DOI : 10.1084/jem.20011470

Z. Jiang, T. Mak, G. Sen, and X. Li, Toll-like receptor 3-mediated activation of NF-??B and IRF3 diverges at Toll-IL-1 receptor domain-containing adapter inducing IFN-??, Proceedings of the National Academy of Sciences, vol.101, issue.10, pp.3533-3538, 2004.
DOI : 10.1073/pnas.0308496101

Z. Jiang, M. Zamanian-daryoush, H. Nie, A. Silva, and B. Williams, Poly(dI{middle dot}dC)-induced Toll-like Receptor 3 (TLR3)-mediated Activation of NFkappa B and MAP Kinase Is through an Interleukin-1 Receptor-associated Kinase (IRAK)-independent Pathway Employing the Signaling Components TLR3-TRAF6-TAK1-TAB2-PKR, Journal of Biological Chemistry, vol.278, issue.19, pp.16713-16719, 2003.
DOI : 10.1074/jbc.M300562200

H. Hacker, V. Redecke, B. Blagoev, I. Kratchmarova, and L. Hsu, Specificity in Toll-like receptor signalling through distinct effector functions of TRAF3 and TRAF6, Nature, vol.18, issue.7073, pp.204-207, 2006.
DOI : 10.1038/nature04369

M. Sasai, M. Shingai, K. Funami, M. Yoneyama, and T. Fujita, NAK-Associated Protein 1 Participates in Both the TLR3 and the Cytoplasmic Pathways in Type I IFN Induction, The Journal of Immunology, vol.177, issue.12, pp.8676-8683, 2006.
DOI : 10.4049/jimmunol.177.12.8676

G. Sen and S. Sarkar, Transcriptional signaling by double-stranded RNA: role of TLR3, Cytokine & Growth Factor Reviews, vol.16, issue.1, pp.1-14, 2005.
DOI : 10.1016/j.cytogfr.2005.01.006

C. Farina, M. Krumbholz, T. Giese, G. Hartmann, and F. Aloisi, Preferential expression and function of Toll-like receptor 3 in human astrocytes, Journal of Neuroimmunology, vol.159, issue.1-2, pp.12-19, 2005.
DOI : 10.1016/j.jneuroim.2004.09.009

C. Jack, N. Arbour, J. Manusow, V. Montgrain, and M. Blain, TLR Signaling Tailors Innate Immune Responses in Human Microglia and Astrocytes, The Journal of Immunology, vol.175, issue.7, pp.4320-4330, 2005.
DOI : 10.4049/jimmunol.175.7.4320

C. Prehaud, F. Megret, M. Lafage, and M. Lafon, Virus Infection Switches TLR-3-Positive Human Neurons To Become Strong Producers of Beta Interferon, Journal of Virology, vol.79, issue.20, pp.12893-12904, 2005.
DOI : 10.1128/JVI.79.20.12893-12904.2005

A. Jackson, J. Rossiter, and M. Lafon, Expression of Toll-like receptor 3 in the human cerebellar cortex in rabies, herpes simplex encephalitis, and other neurological diseases, Journal of Neurovirology, vol.12, issue.3, pp.229-234, 2006.
DOI : 10.1080/13550280600848399

M. Lafon, F. Megret, M. Lafage, and C. Prehaud, The Innate Immune Facet of Brain: Human Neurons Express TLR-3 and Sense Viral dsRNA, Journal of Molecular Neuroscience, vol.29, issue.3, pp.185-194, 2006.
DOI : 10.1385/JMN:29:3:185

J. Cameron, L. Alexopoulou, J. Sloane, A. Dibernardo, and Y. Ma, Toll-Like Receptor 3 Is a Potent Negative Regulator of Axonal Growth in Mammals, Journal of Neuroscience, vol.27, issue.47, pp.13033-13041, 2007.
DOI : 10.1523/JNEUROSCI.4290-06.2007
URL : https://hal.archives-ouvertes.fr/hal-00295070

M. Matsumoto, K. Funami, M. Tanabe, H. Oshiumi, and M. Shingai, Subcellular Localization of Toll-Like Receptor 3 in Human Dendritic Cells, The Journal of Immunology, vol.171, issue.6, pp.3154-3162, 2003.
DOI : 10.4049/jimmunol.171.6.3154

K. Funami, M. Matsumoto, H. Oshiumi, T. Akazawa, and A. Yamamoto, The cytoplasmic 'linker region' in Toll-like receptor 3 controls receptor localization and signaling, International Immunology, vol.16, issue.8, pp.1143-1154, 2004.
DOI : 10.1093/intimm/dxh115

I. Johnsen, T. Nguyen, M. Ringdal, A. Tryggestad, and O. Bakke, Toll-like receptor 3 associates with c-Src tyrosine kinase on endosomes to initiate antiviral signaling, The EMBO Journal, vol.301, issue.14, pp.3335-3346, 2006.
DOI : 10.1038/sj.emboj.7601222

Y. Kim, M. Brinkmann, M. Paquet, and H. Ploegh, UNC93B1 delivers nucleotide-sensing toll-like receptors to endolysosomes, Nature, vol.169, issue.7184, pp.234-238, 2008.
DOI : 10.1038/nature06726

M. Chelbi-alix, A. Vidy, J. Bougrini, and D. Blondel, Rabies Viral Mechanisms to Escape the IFN System: The Viral Protein P Interferes with IRF-3, Stat1, and PML Nuclear Bodies, Journal of Interferon & Cytokine Research, vol.26, issue.5, pp.271-280, 2006.
DOI : 10.1089/jir.2006.26.271
URL : https://hal.archives-ouvertes.fr/inserm-00091617

P. Lewis, Y. Fu, and T. Lentz, Rabies Virus Entry into Endosomes in IMR-32 Human Neuroblastoma Cells, Experimental Neurology, vol.153, issue.1, pp.65-73, 1998.
DOI : 10.1006/exnr.1998.6879

Y. Ni, Y. Iwatani, K. Morimoto, and A. Kawai, Studies on Unusual Cytoplasmic Structures which Contain Rabies Virus Envelope Proteins, Journal of General Virology, vol.77, issue.9, pp.2137-2147, 1996.
DOI : 10.1099/0022-1317-77-9-2137

K. Kristensson, D. Dastur, D. Manghani, H. Tsiang, and M. Bentivoglio, Rabies: interactions between neurons and viruses. A review of the history of Negri inclusion bodies, Neuropathology and Applied Neurobiology, vol.22, issue.3, pp.179-187, 1996.
DOI : 10.1046/j.1365-2990.1996.2898028.x

A. Jackson, H. Ye, C. Ridaura-sanz, and E. Lopez-corella, Quantitative study of the infection in brain neurons in human rabies, Journal of Medical Virology, vol.33, issue.3, pp.614-618, 2001.
DOI : 10.1002/jmv.2080

T. Shin, D. Weinstock, M. Castro, A. Hamir, and T. Wampler, Immunohistochemical Localization of Endothelial and Inducible Nitric Oxide Synthase within Neurons of Cattle with Rabies, Journal of Veterinary Medical Science, vol.66, issue.5, pp.539-541, 2004.
DOI : 10.1292/jvms.66.539

R. Kopito, Aggresomes, inclusion bodies and protein aggregation, Trends in Cell Biology, vol.10, issue.12, pp.524-530, 2000.
DOI : 10.1016/S0962-8924(00)01852-3

J. Johnston, C. Ward, and R. Kopito, Aggresomes: A Cellular Response to Misfolded Proteins, The Journal of Cell Biology, vol.269, issue.7, pp.1883-1898, 1998.
DOI : 10.1083/jcb.87.1.160

R. Garcia-mata, Z. Bebok, E. Sorscher, and E. Sztul, Characterization and Dynamics of Aggresome Formation by a Cytosolic Gfp-Chimera???, The Journal of Cell Biology, vol.269, issue.6, pp.1239-1254, 1999.
DOI : 10.1146/annurev.bb.22.060193.000331

T. Wileman, Aggresomes and Pericentriolar Sites of Virus Assembly: Cellular Defense or Viral Design?, Annual Review of Microbiology, vol.61, issue.1, pp.149-167, 2007.
DOI : 10.1146/annurev.micro.57.030502.090836

T. Wileman, Aggresomes and Autophagy Generate Sites for Virus Replication, Science, vol.312, issue.5775, pp.875-878, 2006.
DOI : 10.1126/science.1126766

E. Yang, J. Shin, H. Kim, H. Park, and M. Kim, Cloning of TLR3 Isoform, Yonsei Medical Journal, vol.45, issue.2, pp.359-361, 2004.
DOI : 10.3349/ymj.2004.45.2.359

N. Lukacs, Detection of virus infection in plants and differentiation between coexisting viruses by monoclonal antibodies to double-stranded RNA, Journal of Virological Methods, vol.47, issue.3, pp.255-272, 1994.
DOI : 10.1016/0166-0934(94)90023-X

J. Schonborn, J. Oberstrass, E. Breyel, J. Tittgen, and J. Schumacher, Monoclonal antibodies to double-stranded RNA as probes of RNA structure in crude nucleic acid extracts, Nucleic Acids Research, vol.19, issue.11, pp.2993-3000, 1991.
DOI : 10.1093/nar/19.11.2993

K. Takeuchi, T. Komatsu, Y. Kitagawa, K. Sada, and B. Gotoh, Sendai Virus C Protein Plays a Role in Restricting PKR Activation by Limiting the Generation of Intracellular Double-Stranded RNA, Journal of Virology, vol.82, issue.20, pp.10102-10110, 2008.
DOI : 10.1128/JVI.00599-08

M. Kumar and G. Carmichael, Antisense RNA: function and fate of duplex RNA in cells of higher eukaryotes, Microbiol Mol Biol Rev, vol.62, pp.1415-1434, 1998.

F. Weber, V. Wagner, S. Rasmussen, R. Hartmann, and S. Paludan, Double-Stranded RNA Is Produced by Positive-Strand RNA Viruses and DNA Viruses but Not in Detectable Amounts by Negative-Strand RNA Viruses, Journal of Virology, vol.80, issue.10, pp.5059-5064, 2006.
DOI : 10.1128/JVI.80.10.5059-5064.2006

J. Johnston, M. Illing, and R. Kopito, Cytoplasmic dynein/dynactin mediates the assembly of aggresomes, Cell Motility and the Cytoskeleton, vol.139, issue.1, pp.26-38, 2002.
DOI : 10.1002/cm.10057

J. Dictenberg, W. Zimmerman, C. Sparks, A. Young, and C. Vidair, Pericentrin and ??-Tubulin Form a Protein Complex and Are Organized into a Novel Lattice at the Centrosome, The Journal of Cell Biology, vol.108, issue.1, pp.163-174, 1998.
DOI : 10.1038/378578a0

D. Groskreutz, M. Monick, L. Powers, T. Yarovinsky, and D. Look, Respiratory Syncytial Virus Induces TLR3 Protein and Protein Kinase R, Leading to Increased Double-Stranded RNA Responsiveness in Airway Epithelial Cells, The Journal of Immunology, vol.176, issue.3, pp.1733-1740, 2006.
DOI : 10.4049/jimmunol.176.3.1733

J. Hennetin, B. Jullian, A. Steven, and A. Kajava, Standard Conformations of ??-Arches in ??-Solenoid Proteins, Journal of Molecular Biology, vol.358, issue.4, pp.1094-1105, 2006.
DOI : 10.1016/j.jmb.2006.02.039

G. Matsumoto, S. Kim, and R. Morimoto, Huntingtin and Mutant SOD1 Form Aggregate Structures with Distinct Molecular Properties in Human Cells, Journal of Biological Chemistry, vol.281, issue.7, pp.4477-4485, 2006.
DOI : 10.1074/jbc.M509201200

S. Suhr, M. Senut, J. Whitelegge, K. Faull, and D. Cuizon, Identities of Sequestered Proteins in Aggregates from Cells with Induced Polyglutamine Expression, The Journal of Cell Biology, vol.16, issue.2, pp.283-294, 2001.
DOI : 10.1146/annurev.neuro.23.1.217

F. Opazo, A. Krenz, S. Heermann, J. Schulz, and B. Falkenburger, Accumulation and clearance of alpha-synuclein aggregates demonstrated by time-lapse imaging, J Neurochem, 2008.

P. Nedellec, P. Vicart, C. Laurent-winter, C. Martinat, and M. Prevost, Interaction of Theiler's virus with intermediate filaments of infected cells, J Virol, vol.72, pp.9553-9560, 1998.

A. Sharpe, L. Chen, and B. Fields, The interaction of mammalian reoviruses with the cytoskeleton of monkey kidney CV-1 cells, Virology, vol.120, issue.2, pp.399-411, 1982.
DOI : 10.1016/0042-6822(82)90040-X

N. Nozawa, Y. Yamauchi, K. Ohtsuka, Y. Kawaguchi, and Y. Nishiyama, Formation of aggresome-like structures in herpes simplex virus type 2-infected cells and a potential role in virus assembly, Experimental Cell Research, vol.299, issue.2, pp.486-497, 2004.
DOI : 10.1016/j.yexcr.2004.06.010

R. Novoa, G. Calderita, R. Arranz, J. Fontana, and H. Granzow, Virus factories: associations of cell organelles for viral replication and morphogenesis, Biology of the Cell, vol.73, issue.Suppl., pp.147-172, 2005.
DOI : 10.1042/BC20040058

B. Salaun, I. Coste, M. Rissoan, S. Lebecque, and T. Renno, TLR3 Can Directly Trigger Apoptosis in Human Cancer Cells, The Journal of Immunology, vol.176, issue.8, pp.4894-4901, 2006.
DOI : 10.4049/jimmunol.176.8.4894

M. Tanaka, Y. Kim, G. Lee, E. Junn, and T. Iwatsubo, Aggresomes Formed by ??-Synuclein and Synphilin-1 Are Cytoprotective, Journal of Biological Chemistry, vol.279, issue.6, pp.4625-4631, 2004.
DOI : 10.1074/jbc.M310994200

S. Pleasure, C. Page, and V. Lee, Pure, postmitotic, polarized human neurons derived from NTera 2 cells provide a system for expressing exogenous proteins in terminally differentiated neurons, J Neurosci, vol.12, pp.1802-1815, 1992.

W. Cheung, W. Fu, W. Hui, and N. Ip, Production of human CNS neurons from embryonal carcinoma cells using a cell aggregation method, Biotechniques, vol.26, pp.946-948, 1999.

F. Paquet-durand, S. Tan, and G. Bicker, Turning teratocarcinoma cells into neurons: rapid differentiation of NT-2 cells in floating spheres, Developmental Brain Research, vol.142, issue.2, pp.161-167, 2003.
DOI : 10.1016/S0165-3806(03)00065-8

M. Sato, H. Tanaka, T. Yamada, and N. Yamamoto, Persistent infection of BHK21/WI-2 cells with rubella virus and characterization of rubella variants, Archives of Virology, vol.256, issue.4, pp.333-343, 1977.
DOI : 10.1007/BF01314778

N. Janabi, S. Peudenier, B. Heron, K. Ng, and M. Tardieu, Establishment of human microglial cell lines after transfection of primary cultures of embryonic microglial cells with the SV40 large T antigen, Neuroscience Letters, vol.195, issue.2, pp.105-108, 1995.
DOI : 10.1016/0304-3940(94)11792-H

S. Camelo, M. Lafage, A. Galelli, and M. Lafon, Selective role for the p55 Kd TNF-?? receptor in immune unresponsiveness induced by an acute viral encephalitis, Journal of Neuroimmunology, vol.113, issue.1, pp.95-108, 2001.
DOI : 10.1016/S0165-5728(00)00427-6

M. Thoulouze, M. Lafage, M. Schachner, U. Hartmann, and H. Cremer, The neural cell adhesion molecule is a receptor for rabies virus, J Virol, vol.72, pp.7181-7190, 1998.

J. Skare, W. Summers, and W. Summers, Structure and function of herpesvirus genomes. I. comparison of five HSV-1 and two HSV-2 strains by cleavage their DNA with eco R I restriction endonuclease, J Virol, vol.15, pp.726-732, 1975.

M. Lafon and M. Lafage, Antiviral Activity of Monoclonal Antibodies Specific for the Internal Proteins N and NS of Rabies Virus, Journal of General Virology, vol.68, issue.12, pp.3113-3123, 1987.
DOI : 10.1099/0022-1317-68-12-3113

B. Dietzschold, M. Lafon, H. Wang, L. Otvos, . Jr et al., Localization and immunological characterization of antigenic domains of the rabies virus internal N and NS proteins, Virus Research, vol.8, issue.2, pp.103-125, 1987.
DOI : 10.1016/0168-1702(87)90023-2

M. Lafon, P. Perrin, P. Versmisse, and P. Sureau, Use of a monoclonal antibody for quantitation of rabies vaccine glycoprotein by enzyme immunoassay, Journal of Biological Standardization, vol.13, issue.4, pp.295-301, 1985.
DOI : 10.1016/S0092-1157(85)80042-1